Peanut Marker Database

TC1E06 Information

Marker name TC1E06
Marker category Publicly available markers
Primer sequences Fw ACCGTTACGAACGCTTTGTC
Rv TCCCTCTCATACGACACCCT
EST/Genome sequences DQ099165
Lines
PIC Value
Lines
Map BF6 Linkage BB03
Position 2.902
TF6 Linkage TA03
Position 20.913
Integrated consensus map Linkage B03
Position 39.845
Integrated consensus map Linkage A03
Position 58.043
SNP Position
Method
SSR Fragment size
Pattern*
Repeat count
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Moretzsohn et al. (2005)
ABS0285

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea