Peanut Marker Database

TC1E01 Information

Marker name TC1E01
Marker category Publicly available markers
Primer sequences Fw CAGCAAAGAGTCGTCAGTCG
Rv GAAAGTTCACTTGAGCAAATTCA
EST/Genome sequences DQ099178
Lines
PIC Value
Lines
Map BF6 Linkage BB02
Position 21.597
TF6 Linkage TB02
Position 54.107
TF6 Linkage TA02
Position 76.842
Integrated consensus map Linkage A02
Position 69.425
Integrated consensus map Linkage B02
Position 77.308
SNP Position
Method
SSR Fragment size
Pattern*
Repeat count
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Moretzsohn et al. (2005)
ABS0283

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea