Peanut Marker Database

TC1D12 Information

Marker name TC1D12
Marker category Publicly available markers
Primer sequences Fw CCCTTTCATTCTCCCTTTCC
Rv TTCTCCTGCACTAGGTTTCCA
EST/Genome sequences DQ099164
Lines
PIC Value
Lines
Map AF5 Linkage AA05
Position 42.552
Integrated consensus map Linkage B05
Position 43.414
Integrated consensus map Linkage A05
Position 44.411
SNP Position
Method
SSR Fragment size
Pattern*
Repeat count
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Moretzsohn et al. (2005)
ABS0282

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea