Marker name | TC1A02 | ||
---|---|---|---|
Marker category | Publicly available markers | ||
Primer sequences | Fw | GCAATTTGCACATTATCCGA | |
Rv | CATGTTCGGTTTCAAGTCTCAA | ||
EST/Genome sequences | DQ099163 | ||
Lines | |||
PIC | Value | ||
Lines | |||
Map | SKF2 | Linkage | LG03.1 |
Position | 94.705 | ||
SKF2 | Linkage | LG07.2 | |
Position | 53.746 | ||
BF6 | Linkage | BB06 | |
Position | 19.836 | ||
TF6 | Linkage | TA06 | |
Position | 54.507 | ||
Integrated consensus map | Linkage | A06 | |
Position | 63.576 | ||
Integrated consensus map | Linkage | B03 | |
Position | 25.97 | ||
Integrated consensus map | Linkage | B06 | |
Position | 89.598 | ||
Integrated consensus map | Linkage | B07 | |
Position | 46.371 | ||
SNP | Position | ||
Method | |||
SSR | Fragment size | ||
Pattern* | |||
Repeat count | |||
Method | PCR | ||
Detection | |||
Multiplex | |||
Gel image | |||
Enzyme | |||
Related markers | Marker name | ||
Species | |||
Comments | Moretzsohn et al. (2005) ABS0277 |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.