Peanut Marker Database

TC14H09 Information

Marker name TC14H09
Marker category Publicly available markers
Primer sequences Fw GAATCTTTGCGCTCTTTCTCAC
Rv AAAACCCGATTCACAAACTGAC
EST/Genome sequences JN887498
Lines
PIC Value
Lines
Map AF5 Linkage AA01
Position 67.24
BF6 Linkage BB01
Position 11.642
Integrated consensus map Linkage B01
Position 42.374
Integrated consensus map Linkage A01
Position 120.221
SNP Position
Method
SSR Fragment size
Pattern*
Repeat count
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Macedo et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea