Peanut Marker Database

TC11B04 Information

Marker name TC11B04
Marker category Publicly available markers
Primer sequences Fw GATCTGAAGGCTCTGATACCAT
Rv GATCTCAACCAGAACAGTATGC
EST/Genome sequences DQ099237
Lines
PIC Value
Lines
Map TF6 Linkage TA04
Position 90.713
Integrated consensus map Linkage A10
Position 105.212
Integrated consensus map Linkage B05
Position 60.462
Integrated consensus map Linkage A04
Position 76.2
SNP Position
Method
SSR Fragment size
Pattern*
Repeat count
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Moretzsohn et al. (2005)
ABS0366

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea