Peanut Marker Database

TC11A04 Information

Marker name TC11A04
Marker category Publicly available markers
Primer sequences Fw ACTCTGCATGGATGGCTACAG
Rv CATGTTCGGTTTCAAGTCTCAA
EST/Genome sequences DQ099236
Lines
PIC Value
Lines
Map SKF2 Linkage LG06.2
Position 60.319
SKF2 Linkage LG06.1
Position 27.809
AF5 Linkage AA06
Position 36.977
BF6 Linkage BB06
Position 26.458
TF6 Linkage TA06
Position 64.144
Integrated consensus map Linkage A06
Position 62.721
Integrated consensus map Linkage A10
Position 84.112
Integrated consensus map Linkage B06
Position 91.458
SNP Position
Method
SSR Fragment size
Pattern*
Repeat count
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Moretzsohn et al. (2005)
ABS0365

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea