Peanut Marker Database

TC11A02 Information

Marker name TC11A02
Marker category Publicly available markers
Primer sequences Fw AATCGGAATGGCAAGAGACA
Rv AGAGCAAAGGGCGAATCTATG
EST/Genome sequences DQ099155
Lines
PIC Value
Lines
Map SKF2 Linkage LG02.2
Position 33.39
AF5 Linkage AA10
Position 26.915
Integrated consensus map Linkage B10
Position 69.003
Integrated consensus map Linkage A10
Position 89.265
SNP Position
Method
SSR Fragment size
Pattern*
Repeat count
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Moretzsohn et al. (2005)
ABS0364

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea