Peanut Marker Database

Seq7D09 Information

Marker name Seq7D09
Marker category Publicly available markers
Primer sequences Fw TTAGACGACAGCTTTTCCCG
Rv GAGATGGGAAGAGCACCTTG
EST/Genome sequences Seq7D09
Lines
PIC Value
Lines
Map TF6 Linkage TA05
Position 39.083
TF6 Linkage TB05
Position 57.589
Integrated consensus map Linkage B05
Position 92.181
Integrated consensus map Linkage A05
Position 64.861
SNP Position
Method
SSR Fragment size
Pattern*
Repeat count
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Ferguson et al. (2004)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea