Peanut Marker Database

Seq5D05 Information

Marker name Seq5D05
Marker category Publicly available markers
Primer sequences Fw AAAAGAAAGACCTTCCCCGA
Rv GCAGGTAATCTGCCGTGATT
EST/Genome sequences CC000433
Lines
PIC Value
Lines
Map SKF2 Linkage LG07.2
Position 56.897
SKF2 Linkage LG07.2
Position 85.964
SKF2 Linkage LG03.1
Position 95.32
SKF2 Linkage LG07.1
Position 56.936
BF6 Linkage BB07
Position 7.782
TF6 Linkage TA07
Position 17.287
TF6 Linkage TB07
Position 0.0
Integrated consensus map Linkage B03
Position 26.025
Integrated consensus map Linkage B07
Position 50.184
Integrated consensus map Linkage B07
Position 55.56
Integrated consensus map Linkage B07
Position 79.141
Integrated consensus map Linkage A07
Position 49.124
SNP Position
Method
SSR Fragment size
Pattern*
Repeat count
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Ferguson et al. (2004)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea