Peanut Marker Database

Seq5B02 Information

Marker name Seq5B02
Marker category Publicly available markers
Primer sequences Fw GAGGTCGCCATAGTCATCGT
Rv AAAATGTTGGGTGTTGGCAT
EST/Genome sequences Seq5B02
Lines
PIC Value
Lines
Map BF6 Linkage BB07
Position 35.305
Integrated consensus map Linkage B07
Position 90.016
Integrated consensus map Linkage B02
Position 15.486
SNP Position
Method
SSR Fragment size
Pattern*
Repeat count
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Ferguson et al. (2004)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea