Peanut Marker Database

Seq4H11 Information

Marker name Seq4H11
Marker category Publicly available markers
Primer sequences Fw ATCACCATCAGAACGATCCC
Rv TTTGTAGCCTTCTGGCGAGT
EST/Genome sequences CC000423
Lines
PIC Value
Lines
Map TF6 Linkage TA10
Position 6.664
Integrated consensus map Linkage B04
Position 33.622
Integrated consensus map Linkage A01
Position 74.571
Integrated consensus map Linkage A10
Position 94.637
SNP Position
Method
SSR Fragment size
Pattern*
Repeat count
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Ferguson et al. (2004)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea