Peanut Marker Database

Seq4F10 Information

Marker name Seq4F10
Marker category Publicly available markers
Primer sequences Fw TGCGAAACCCCTAACTGACT
Rv TCTATGTTGCTGCCGTTGAC
EST/Genome sequences CC000409
Lines
PIC Value
Lines
Map SKF2 Linkage LG10.1
Position 24.161
BF6 Linkage BB03
Position 23.561
Integrated consensus map Linkage B03
Position 10.989
Integrated consensus map Linkage A03
Position 15.552
SNP Position
Method
SSR Fragment size
Pattern*
Repeat count
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Ferguson et al. (2004)
ABS0630

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea