Peanut Marker Database

Seq4F07 Information

Marker name Seq4F07
Marker category Publicly available markers
Primer sequences Fw ATGCCACTTCCGTTTGCTAC
Rv TTGCTTTGGCCACTGAAAAT
EST/Genome sequences CC000406
Lines
PIC Value
Lines
Map TF6 Linkage TA03
Position 68.622
Integrated consensus map Linkage A03
Position 111.836
Integrated consensus map Linkage A03
Position 108.351
SNP Position
Method
SSR Fragment size
Pattern*
Repeat count
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Ferguson et al. (2004)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea