Peanut Marker Database

Seq3E10 Information

Marker name Seq3E10
Marker category Publicly available markers
Primer sequences Fw TCCCAAAAATAACAAACATGGA
Rv ACGCTTTGAGACTCGTCGTT
EST/Genome sequences CC000339
Lines
PIC Value
Lines
Map Integrated consensus map Linkage B10
Position 91.73
Integrated consensus map Linkage A10
Position 96.769
SNP Position
Method
SSR Fragment size
Pattern*
Repeat count
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Ferguson et al. (2004)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea