Peanut Marker Database

Seq2H08 Information

Marker name Seq2H08
Marker category Publicly available markers
Primer sequences Fw AAGCTAAGTGGGGTGGGAGT
Rv AAGCAGTTTGCGTAAGCATTT
EST/Genome sequences CC000296
Lines
PIC Value
Lines
Map BF6 Linkage BB02
Position 21.482
Integrated consensus map Linkage B03
Position 69.893
Integrated consensus map Linkage B02
Position 73.051
SNP Position
Method
SSR Fragment size
Pattern*
Repeat count
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Ferguson et al. (2004)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea