Peanut Marker Database

Seq2F05 Information

Marker name Seq2F05
Marker category Publicly available markers
Primer sequences Fw TGACCAAAGTGATGAAGGGA
Rv AAGTTGTTTGTACATCTGTCATCG
EST/Genome sequences CC000277
Lines
PIC Value
Lines
Map SKF2 Linkage LG06.2
Position 60.911
TF6 Linkage TA02
Position 86.264
TF6 Linkage TB02
Position 76.909
Integrated consensus map Linkage B06
Position 93.268
Integrated consensus map Linkage A02
Position 76.971
Integrated consensus map Linkage B02
Position 95.257
SNP Position
Method
SSR Fragment size
Pattern*
Repeat count
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Ferguson et al. (2004)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea