Peanut Marker Database

Seq2C11 Information

Marker name Seq2C11
Marker category Publicly available markers
Primer sequences Fw TGACCTCAATTTTGGGGAAG
Rv GCCACTATTCATCGCGGTA
EST/Genome sequences CC000258
Lines
PIC Value
Lines
Map BF6 Linkage BB03
Position 20.333
Integrated consensus map Linkage B03
Position 57.106
Integrated consensus map Linkage A03
Position 103.453
SNP Position
Method
SSR Fragment size
Pattern*
Repeat count
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Ferguson et al. (2004)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea