Peanut Marker Database

Seq19H03 Information

Marker name Seq19H03
Marker category Publicly available markers
Primer sequences Fw TGGCAGGCAGTAAACATCAG
Rv TTGAGGACGTGATGAACTGG
EST/Genome sequences CC000140
Lines
PIC Value
Lines
Map Integrated consensus map Linkage A06
Position 109.537
Integrated consensus map Linkage B01
Position 35.875
Integrated consensus map Linkage B03
Position 64.801
Integrated consensus map Linkage B05
Position 58.665
Integrated consensus map Linkage A03
Position 116.855
SNP Position
Method
SSR Fragment size
Pattern*
Repeat count
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Ferguson et al. (2004)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea