Peanut Marker Database

Seq19G07 Information

Marker name Seq19G07
Marker category Publicly available markers
Primer sequences Fw ATTCAATTCCTCTCTCCCCC
Rv TCAATCAATCAATCGCAGGA
EST/Genome sequences CC000133
Lines
PIC Value
Lines
Map SKF2 Linkage LG07.2
Position 88.811
SKF2 Linkage LG03.2
Position 33.357
SKF2 Linkage LG07.2
Position 51.12
TF6 Linkage TA03
Position 72.591
Integrated consensus map Linkage A03
Position 106.084
Integrated consensus map Linkage B07
Position 43.533
Integrated consensus map Linkage B07
Position 83.884
SNP Position
Method
SSR Fragment size
Pattern*
Repeat count
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Ferguson et al. (2004)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea