Peanut Marker Database

Seq19C03 Information

Marker name Seq19C03
Marker category Publicly available markers
Primer sequences Fw TCATCGCCAAACTCTTCTCC
Rv TCGAAGAGTGCATGTTGACC
EST/Genome sequences CC000090
Lines
PIC Value
Lines
Map BF6 Linkage BB01
Position 29.998
Integrated consensus map Linkage B01
Position 24.602
Integrated consensus map Linkage B07
Position 87.37
Integrated consensus map Linkage A01
Position 79.953
SNP Position
Method
SSR Fragment size
Pattern*
Repeat count
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Ferguson et al. (2004)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea