Peanut Marker Database

Seq18G09 Information

Marker name Seq18G09
Marker category Publicly available markers
Primer sequences Fw ATATCAGCGCCAATGACTCC
Rv TCGCTCCTGGCACCTATATC
EST/Genome sequences CC000055
Lines
PIC Value
Lines
Map Integrated consensus map Linkage B01
Position 44.409
Integrated consensus map Linkage A03
Position 63.088
Integrated consensus map Linkage A06
Position 47.996
SNP Position
Method
SSR Fragment size
Pattern*
Repeat count
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Ferguson et al. (2004)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea