Peanut Marker Database

Seq18C05 Information

Marker name Seq18C05
Marker category Publicly available markers
Primer sequences Fw GGACAGCCGGATGCTATTTA
Rv ACATGAGTCCCTTTTCCCTT
EST/Genome sequences CC000011
Lines
PIC Value
Lines
Map SKF2 Linkage LG04.2
Position 66.751
TF6 Linkage TA04
Position 67.811
Integrated consensus map Linkage B04
Position 119.874
Integrated consensus map Linkage A04
Position 64.989
SNP Position
Method
SSR Fragment size
Pattern*
Repeat count
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Ferguson et al. (2004)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea