Peanut Marker Database

Seq16G08 Information

Marker name Seq16G08
Marker category Publicly available markers
Primer sequences Fw CTCAAAAAGCGCTTAGCCAC
Rv CTGCCTACTGCCTACTGCCT
EST/Genome sequences BZ999888
Lines
PIC Value
Lines
Map AF5 Linkage AA01
Position 8.794
TF6 Linkage TB01
Position 0.0
Integrated consensus map Linkage A09
Position 93.36
Integrated consensus map Linkage B01
Position 80.123
Integrated consensus map Linkage A01
Position 65.508
SNP Position
Method
SSR Fragment size
Pattern*
Repeat count
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Ferguson et al. (2004)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea