Peanut Marker Database

Seq15D03 Information

Marker name Seq15D03
Marker category Publicly available markers
Primer sequences Fw CATGCCATCATCACAACACA
Rv GGAGGAAGCAATGGTTTCAG
EST/Genome sequences BZ999779
Lines
PIC Value
Lines
Map AF5 Linkage AA06
Position 15.232
Integrated consensus map Linkage B03
Position 71.182
Integrated consensus map Linkage A06
Position 44.484
SNP Position
Method
SSR Fragment size
Pattern*
Repeat count
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Ferguson et al. (2004)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea