Peanut Marker Database

Seq15C12 Information

Marker name Seq15C12
Marker category Publicly available markers
Primer sequences Fw ACAATGCAATGACCGTTGTT
Rv TTGTTGCATGAGAACGTGAA
EST/Genome sequences BZ999776
Lines
PIC Value
Lines
Map SKF2 Linkage LG04.2
Position 96.501
SKF2 Linkage LG04.1
Position 17.528
Integrated consensus map Linkage A04
Position 75.385
Integrated consensus map Linkage B04
Position 88.755
SNP Position
Method
SSR Fragment size
Pattern*
Repeat count
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Ferguson et al. (2004)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea