Peanut Marker Database

Seq14G03 Information

Marker name Seq14G03
Marker category Publicly available markers
Primer sequences Fw CAATTTTATTTGCCACATGCT
Rv TCGCAGTTCTCAAAGTTATCG
EST/Genome sequences BZ999725
Lines
PIC Value
Lines
Map BF6 Linkage BB03
Position 15.393
TF6 Linkage TB02
Position 59.253
Integrated consensus map Linkage B03
Position 52.257
Integrated consensus map Linkage B02
Position 88.484
SNP Position
Method
SSR Fragment size
Pattern*
Repeat count
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Ferguson et al. (2004)
ABS0642

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea