| Marker name | Seq14G03 | ||
|---|---|---|---|
| Marker category | Publicly available markers | ||
| Primer sequences | Fw | CAATTTTATTTGCCACATGCT | |
| Rv | TCGCAGTTCTCAAAGTTATCG | ||
| EST/Genome sequences | BZ999725 | ||
| Lines | |||
| PIC | Value | ||
| Lines | |||
| Map | BF6 | Linkage | BB03 |
| Position | 15.393 | ||
| TF6 | Linkage | TB02 | |
| Position | 59.253 | ||
| Integrated consensus map | Linkage | B02 | |
| Position | 88.484 | ||
| Integrated consensus map | Linkage | B03 | |
| Position | 52.257 | ||
| SNP | Position | ||
| Method | |||
| SSR | Fragment size | ||
| Pattern* | |||
| Repeat count | |||
| Method | PCR | ||
| Detection | |||
| Multiplex | |||
| Gel image | |||
| Enzyme | |||
| Related markers | Marker name | ||
| Species | |||
| Comments | Ferguson et al. (2004) ABS0642 |
||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.