Peanut Marker Database

Seq14D11 Information

Marker name Seq14D11
Marker category Publicly available markers
Primer sequences Fw ACGCTAGTCCCTTTGCTTTG
Rv AAACAATCCTTTCTTTGGATGG
EST/Genome sequences BZ999700
Lines
PIC Value
Lines
Map SKF2 Linkage LG04.1
Position 48.722
Integrated consensus map Linkage B04
Position 72.912
Integrated consensus map Linkage B07
Position 72.152
Integrated consensus map Linkage B02
Position 71.167
SNP Position
Method
SSR Fragment size
Pattern*
Repeat count
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Ferguson et al. (2004)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea