Peanut Marker Database

Seq14C11 Information

Marker name Seq14C11
Marker category Publicly available markers
Primer sequences Fw CGTTGGGGACAAAAACGATA
Rv TTTTCTTGAAACTCGTTGATATGG
EST/Genome sequences BZ999693
Lines
PIC Value
Lines
Map TF6 Linkage TB03
Position 96.483
Integrated consensus map Linkage B03
Position 68.189
Integrated consensus map Linkage B03
Position 86.906
Integrated consensus map Linkage B03
Position 55.899
SNP Position
Method
SSR Fragment size
Pattern*
Repeat count
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Ferguson et al. (2004)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea