Peanut Marker Database

Seq11G07 Information

Marker name Seq11G07
Marker category Publicly available markers
Primer sequences Fw CATGTCTCCATGAGCATTTCA
Rv TGGATGTGGACAGCATATCG
EST/Genome sequences BZ999490
Lines
PIC Value
Lines
Map SKF2 Linkage LG02.3
Position 22.646
SKF2 Linkage LG08.2
Position 55.819
Integrated consensus map Linkage B08
Position 52.201
Integrated consensus map Linkage A02
Position 37.738
SNP Position
Method
SSR Fragment size
Pattern*
Repeat count
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Ferguson et al. (2004)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea