Peanut Marker Database

RN34H10 Information

Marker name RN34H10
Marker category Publicly available markers
Primer sequences Fw CACCTCAAAAGCGAAGATTGT
Rv GGATATAAATATAGCTAGGAGCCTGTG
EST/Genome sequences RN34H10
Lines
PIC Value
Lines
Map TF6 Linkage TB05
Position 5.191
Integrated consensus map Linkage B05
Position 16.866
Integrated consensus map Linkage A06
Position 59.278
SNP Position
Method
SSR Fragment size
Pattern*
Repeat count
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Proite et al. (2007)
ABS0557

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea