Peanut Marker Database

RN31E11 Information

Marker name RN31E11
Marker category Publicly available markers
Primer sequences Fw TTCTCTCTCTAAATCGGGTTCG
Rv AAGCCTCTGGAAGGTGGAG
EST/Genome sequences EH043199
Lines
PIC Value
Lines
Map TF6 Linkage TA05
Position 46.7
TF6 Linkage TB05
Position 67.687
Integrated consensus map Linkage B05
Position 106.122
Integrated consensus map Linkage A05
Position 71.482
SNP Position
Method
SSR Fragment size
Pattern*
Repeat count
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Proite et al. (2007)
ABS0539

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea