Peanut Marker Database

RN12E01 Information

Marker name RN12E01
Marker category Publicly available markers
Primer sequences Fw TTCTTTTACAACCCACACACCA
Rv TGGTCATGCTTTCAATCACTTC
EST/Genome sequences DQ099081
Lines
PIC Value
Lines
Map BF6 Linkage BB04
Position 66.889
Integrated consensus map Linkage B04
Position 111.485
Integrated consensus map Linkage A04
Position 83.393
SNP Position
Method
SSR Fragment size
Pattern*
Repeat count
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Moretzsohn et al. (2005)
ABS0445

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea