Peanut Marker Database

RN10F09 Information

Marker name RN10F09
Marker category Publicly available markers
Primer sequences Fw CCATCCAGAAAAGCGAAATC
Rv CAATGAAGAAGAATCCGAAACC
EST/Genome sequences DQ099077
Lines
PIC Value
Lines
Map BF6 Linkage BB03
Position 11.552
TF6 Linkage TA03
Position 25.031
Integrated consensus map Linkage B03
Position 47.884
Integrated consensus map Linkage A03
Position 63.95
SNP Position
Method
SSR Fragment size
Pattern*
Repeat count
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Moretzsohn et al. (2005)
ABS0441

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea