Peanut Marker Database

RN0x615 Information

Marker name RN0x615
Marker category Publicly available markers
Primer sequences Fw GGGCATTTAAGGGACAATGG
Rv CCCGACCCACACATTTAACATA
EST/Genome sequences DQ099115
Lines
PIC Value
Lines
Map SKF2 Linkage LG02.3
Position 20.835
SKF2 Linkage LG02.1
Position 70.244
SKF2 Linkage LG02.2
Position 31.583
AF5 Linkage AA02
Position 21.005
Integrated consensus map Linkage A02
Position 38.856
Integrated consensus map Linkage B02
Position 64.738
Integrated consensus map Linkage B10
Position 70.57
SNP Position
Method
SSR Fragment size
Pattern*
Repeat count
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Moretzsohn et al. (2005)
ABS0409

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea