Peanut Marker Database

RM17H09 Information

Marker name RM17H09
Marker category Publicly available markers
Primer sequences Fw CCCATCACAGTTGGCATATCT
Rv TGTAGTGGATTAGACAGCCCC
EST/Genome sequences EH046786
Lines
PIC Value
Lines
Map TF6 Linkage TA08
Position 69.048
Integrated consensus map Linkage A08
Position 83.966
Integrated consensus map Linkage A04
Position 49.768
SNP Position
Method
SSR Fragment size
Pattern*
Repeat count
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Proite et al. (2007)
ABS0506

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea