Peanut Marker Database

RI2A06 Information

Marker name RI2A06
Marker category Publicly available markers
Primer sequences Fw TTCCTAAACTGGAAGCGTGTTC
Rv CAAGAGCTTTCTTCTGCCATTC
EST/Genome sequences DQ099043
Lines
PIC Value
Lines
Map TF6 Linkage TA02
Position 90.158
Integrated consensus map Linkage B02
Position 94.522
Integrated consensus map Linkage A02
Position 78.64
SNP Position
Method
SSR Fragment size
Pattern*
Repeat count
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Moretzsohn et al. (2005)
ABS0400

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea