Peanut Marker Database

RI1F06 Information

Marker name RI1F06
Marker category Publicly available markers
Primer sequences Fw TGTCTCTCTTCCTTTCCTTGCT
Rv CCTTTTGCTTCTTTGCTTCC
EST/Genome sequences DQ099041
Lines
PIC Value
Lines
Map AF5 Linkage AA02
Position 24.595
TF6 Linkage TA02
Position 46.426
Integrated consensus map Linkage B02
Position 79.398
Integrated consensus map Linkage A02
Position 45.572
Integrated consensus map Linkage B02
Position 70.213
Integrated consensus map Linkage B02
Position 71.868
SNP Position
Method
SSR Fragment size
Pattern*
Repeat count
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Moretzsohn et al. (2005)
ABS0399

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea