Peanut Marker Database

PMc348 Information

Marker name PMc348
Marker category Publicly available markers
Primer sequences Fw TGCCTGTAAGTGTGGACCAA
Rv ACTCCAAAACGGGGAGTGTT
EST/Genome sequences CD038348
Lines
PIC Value
Lines
Map SKF2 Linkage LG04.1
Position 48.338
Integrated consensus map Linkage B05
Position 50.137
Integrated consensus map Linkage B04
Position 70.335
SNP Position
Method
SSR Fragment size
Pattern*
Repeat count
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
He et al. (2003)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea