Peanut Marker Database

PMc297 Information

Marker name PMc297
Marker category Publicly available markers
Primer sequences Fw ATGCACCTGCAAGTGAAGAG
Rv TCAAGGATGCAGCAAGACAC
EST/Genome sequences CD038297
Lines
PIC Value
Lines
Map SKF2 Linkage LG02.2
Position 37.424
SKF2 Linkage LG04.1
Position 47.251
Integrated consensus map Linkage B10
Position 73.103
Integrated consensus map Linkage B04
Position 70.168
SNP Position
Method
SSR Fragment size
Pattern*
Repeat count
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
He et al. (2003)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea