Peanut Marker Database

PM73 Information

Marker name PM73
Marker category Publicly available markers
Primer sequences Fw GGGACTCGGAACAGTGTTTATC
Rv AGTGTTGGGTGTGAAAGTGG
EST/Genome sequences
Lines
PIC Value
Lines
Map AF5 Linkage AA02
Position 18.056
Integrated consensus map Linkage B02
Position 53.964
Integrated consensus map Linkage A02
Position 37.929
SNP Position
Method
SSR Fragment size
Pattern*
Repeat count
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
He et al. (2003)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea