Peanut Marker Database

PM45 Information

Marker name PM45
Marker category Publicly available markers
Primer sequences Fw TGAGTTGTGACGGCTTGTGT
Rv GATGCATGTTTAGCACACTTGA
EST/Genome sequences AY237754
Lines
PIC Value
Lines
Map AF5 Linkage AA05
Position 56.876
TF6 Linkage TA05
Position 24.367
Integrated consensus map Linkage A05
Position 54.003
Integrated consensus map Linkage A05
Position 51.567
SNP Position
Method
SSR Fragment size
Pattern*
Repeat count
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
He et al. (2003)
ABS0169

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea