Peanut Marker Database

PM36 Information

Marker name PM36
Marker category Publicly available markers
Primer sequences Fw ACTCGCCATAGCCAACAAAC
Rv CATTCCCACAACTCCCACAT
EST/Genome sequences AY237749
Lines
PIC Value
Lines
Map BF6 Linkage BB05
Position 16.848
TF6 Linkage TB05
Position 26.325
TF6 Linkage TA05
Position 29.099
Integrated consensus map Linkage A05
Position 54.894
Integrated consensus map Linkage B05
Position 49.56
SNP Position
Method
SSR Fragment size
Pattern*
Repeat count
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
He et al. (2003)
ABS0165

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea