Peanut Marker Database

PM32 Information

Marker name PM32
Marker category Publicly available markers
Primer sequences Fw AGTGTTGGGTGTGAAAGTGG
Rv GGGACTCGGAACAGTGTTTATC
EST/Genome sequences AY237747
Lines
PIC Value
Lines
Map AF5 Linkage AA08
Position 38.535
BF6 Linkage BB02
Position 16.767
TF6 Linkage TA02
Position 47.64
TF6 Linkage TB02
Position 23.47
Integrated consensus map Linkage A08
Position 55.54
Integrated consensus map Linkage B02
Position 59.05
Integrated consensus map Linkage A02
Position 37.304
SNP Position
Method
SSR Fragment size
Pattern*
Repeat count
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
He et al. (2003)
ABS0163

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea