Peanut Marker Database

PM238 Information

Marker name PM238
Marker category Publicly available markers
Primer sequences Fw CTCTCCTCTGCTCTGCACTG
Rv ACAAGAACATGGGGATGAAGA
EST/Genome sequences AY237791
Lines
PIC Value
Lines
Map SKF2 Linkage LG03.1
Position 80.83
BF6 Linkage BB03
Position 12.602
TF6 Linkage TB03
Position 60.578
TF6 Linkage TA03
Position 32.896
Integrated consensus map Linkage A03
Position 72.149
Integrated consensus map Linkage B03
Position 47.365
SNP Position
Method
SSR Fragment size
Pattern*
Repeat count
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
He et al. (2003)
ABS0202

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea