Peanut Marker Database

PM201 Information

Marker name PM201
Marker category Publicly available markers
Primer sequences Fw CCTTTATAGAGGACCTTCCCTCTC
Rv GCCTATTTGGTATCGGCTCA
EST/Genome sequences AY237779
Lines
PIC Value
Lines
Map TF6 Linkage TA10
Position 7.871
Integrated consensus map Linkage A10
Position 93.486
Integrated consensus map Linkage B03
Position 63.895
Integrated consensus map Linkage A03
Position 96.171
SNP Position
Method
SSR Fragment size
Pattern*
Repeat count
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
He et al. (2003)
ABS0191

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea