Peanut Marker Database

Lec1 Information

Marker name Lec1
Marker category Publicly available markers
Primer sequences Fw CAAGCATCAACAACAACGA
Rv GTCCGACCACATACAAGAGTT
EST/Genome sequences
Lines
PIC Value
Lines
Map TF6 Linkage TB09
Position 26.035
TF6 Linkage TA09
Position 64.045
Integrated consensus map Linkage A09
Position 25.16
Integrated consensus map Linkage B09
Position 65.805
SNP Position
Method
SSR Fragment size
Pattern*
Repeat count
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Hopkins et al. (1999)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea