Peanut Marker Database

IPAHM524 Information

Marker name IPAHM524
Marker category Publicly available markers
Primer sequences Fw GCCATGGATAAGAACCTGAAA
Rv CAGTAAGCTGAGCTGGCAGA
EST/Genome sequences ER974548
Lines
PIC Value
Lines
Map Integrated consensus map Linkage B06
Position 73.524
Integrated consensus map Linkage B02
Position 46.112
SNP Position
Method
SSR Fragment size
Pattern*
Repeat count
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Cuc et al. (2008)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea