Peanut Marker Database

IPAHM287 Information

Marker name IPAHM287
Marker category Publicly available markers
Primer sequences Fw TCTAACCCTTCGGTTCATGG
Rv TCACTATCCCATCCCTGCTC
EST/Genome sequences ER974492
Lines
PIC Value
Lines
Map Integrated consensus map Linkage B05
Position 20.249
Integrated consensus map Linkage A01
Position 47.68
Integrated consensus map Linkage B01
Position 49.332
SNP Position
Method
SSR Fragment size
Pattern*
Repeat count
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Cuc et al. (2008)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea