Peanut Marker Database

GM635 Information

Marker name GM635
Marker category Publicly available markers
Primer sequences Fw TTGTGCGAAGGGTAAGATAGAAA
Rv TCCTGTGCTTGAATCTGGAAT
EST/Genome sequences DX514692
Lines
PIC Value
Lines
Map AF5 Linkage AA01
Position 44.74
Integrated consensus map Linkage B01
Position 49.332
Integrated consensus map Linkage B01
Position 55.153
Integrated consensus map Linkage A01
Position 105.431
SNP Position
Method
SSR Fragment size
Pattern*
Repeat count
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Nagy et al. (2010)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea